First report of Potato spindle tuber viroid (PSTVd) in ornamental plants in Greece

Potato spindle tuber viroid (PSTVd) has quarantine status in the European Union. During 2009, a survey of PSTVd in ornamental plants of the species Solanum jasminoides and Brugmansia spp. was conducted in Greece. Samples were collected from 21 commercial nurseries located in central, north, south and west Greece, and consisted of symptomless upper leaves collected at random from 10% of plants within each nursery. A total of 391 samples (315 S. jasminoides and 76 Brugmansia spp.) were examined. Total RNA was extracted from each sample and analysed by reverse transcription polymerase chain reaction (RT-PCR) using two different sets of PSTVd specific primers: PSTVdfw/ PSTVdrev (ATCCCCGGGGAAACCTGGAGCGA, CCCTGAAGCGCTCCTCCGAG) and PSTVd-32/PSTVd-33 (AAACCCTGTTTCGGCGGGAATTAC, TCACCCTTCCTTTCTTCGGGTGTC) respectively(Kalantidis et al., 2007; Di Serio, 2007). From among the 391 samples an amplicon of approximately 360 bp was obtained from two S. jasminoides samples and four Brugmansia spp. samples. Sequencing of PCR products from both ends showed that all Brugmansia isolates (GenBank Acession No. GU481090) were identical to PSTVd isolate 3077740 from Brugmansia suaveolens (EF192394) (Verhoeven et al., 2008). One of the Solanum isolates (GU481091) was identical to PSTVd isolate 3373056 from S. jasminoides (EF192393) (Verhoeven et al., 2008). The other Solanum isolate (GU481092) was 99% identical to intermediate strain PSTVd (AY937179) (Owens &Thompson, 2005). Pathogenicity studies showed infection of tomato plants after mechanical inoculations in a greenhouse under quarantine conditions. Plant tissue derived from the samples found to be PSTVd-positive in the laboratory tests were used as inoculum. PSTVd infections of tomato plants were determined by symptomatology and RT-PCR, followed by direct sequencing of the PCR products. 

Positive samples came from plants in three nurseries from different areas of the country. The four positive samples of Brugmansia spp. were collected from a single nursery in Attica, Central Greece. These plants originated from Italy. The S. jasminoides isolate (GU481091) was collected from a nursery in Messinia, Peloponnese, and classified as of domestic origin while the origin of the second Solanum isolate (GU481092) collected from a nursery in northern Greece is still under investigation. Although infected Brugmansia spp. and S. jasminoides plants did not show any symptoms, they might act as sources of inocula for crops such as potato and tomato. In all cases control measures are being applied. This is the first report of PSTVd in Greece.