Prunus necrotic ringspot virus in apricot (Prunus armeniaca) and peach (P. persica) newly reported in Saudi Arabia

Cultivated areas with fruit trees in Saudi Arabia are estimated at 233,513 ha, with an annual production of more than 1.6 million tonnes of fruits. Prunus necrotic ringspot virus (PNRSV), an important pathogen, had been reported in nearby countries, Jordan, Lebanon and Syria (Myrta et al., 2003). In recent years, apricots (Prunus armeniaca)and peaches (P. persica)in Al Juof, Saudi Arabia, had been found showing chlorotic rings, necrotic spots, and a shothole appearance (Fig. 1). To assess viruses of stone fruit trees as possible causal agents, field surveys were carried out in the spring of 2009. A total of 76 leaf samples (29 apricot and 47 peach trees) were collected for analysis of PNRSV. Double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) was performed using the commercially available PNRSV test kits (Bioreba, Switzerland). Results showed that 34 out of 76 leaf samples (11 apricot and 23 peach) were infected with PNRSV. Total RNA, from the same samples used in the ELISA test, was extracted using the Plant RNeasy Mini Kit (Qiagen, USA) in accordance with appropriate instructions (Jarošová & Kundu, 2010). RT-PCR was performed using PNRSV specific primers PNRSVv (5' GAACCTCCTTCCGATTTAG '3) and PNRSVr (5'GCTTCCCTAACGGGGCATCCAC'3) as described by Sánchez-Navarro et al. (2005). RT-PCR, run on all samples, resulted in the amplification of a 346 bp fragment, indicating the presence of PNRSV in apricots and peaches in Saudi Arabia. One amplicon was sequenced and deposited in GenBank (Accession No. HM584814).The sequence had 99% identity when compared with PNRSV isolate from P. mahaleb (PV-0096) and 98% identity with PNRSV from China (FJ610344) (Guo et al., 1995). Further investigations are needed for other commercial orchards and nurseries to assess the incidence of PNRSV in Saudi Arabia. This is the first report of PNRSV in Saudi Arabia.